Internal control primer used to amplify genomic DNA when paired with primer oMIR14


Category
Primer
Record History
Added on March 5, 2014 at 12:45 PM by Lindner, Jill
Modified on March 5, 2014 at 1:21 PM by Lindner, Jill
Shared with (contributions)
VCSCBi: Training / Primers Master

Primer Annotations

Sequence CTTGGGTGGAGAGGCTATTC
Sequence Length 20 nt
GC Content 55.0%
Molecular Weight 6,204.1 g/mol
Melting Temperature 53.8 ° (Basic, with no salt adjustment)
Stock Concentration 3.3 µg/µL

Source

Commercial Eurofins MWG/Opepron
Catalog #Not provided
Stock Date March 5, 2014

Inventory Location

Private

Attachment

Document 400021_MTRNAIV_EN.pdf - Added on March 5, 2014 at 12:56 PM by Jill Lindner