A complete description of the generation of this null allele of the Type III Transforming Growth Factor Receptor is found in: Compton, LA, Potash, DA, Brown, CB, Barnett, JV. Coronary Vessel Development is Dependent on the Type III Transforming Growth Factor Beta Receptor. Circulation Research 101: 784-791, 2007. 

Generation of null mice:  A targeting vector was made to delete exon 3 that encodes the N-terminus, including a portion of the extracellular ligand-binding domain. The genomic structure of Tgfbr3 was determined by searching the Celera database® using the published mouse cDNA. Sequence fragments were assembled using DNASTAR software to generate a single, contiguous genomic sequence that spanned all 17 Tgfbr3 exons. Oligonucleotides were designed to PCR amplify 5’ and 3’ arms of homology and Tgfbr3 exon 3 from 129 SvEvTac mouse genomic DNA. Primers were as follows:

Long Arm:

Forward 5’ GTCGACTTATAAAAGTTTCTGTGAGGA3’

Reverse 5’ GTCGACGTCAAGGAAACCTCCCAATGG

Short Arm:

Forward 5’CTCGAGTAGTTCCTTATTGAGTTACCA3’

Reverse 5’CTCGAGACCCTACCTCCTTCTTTCCTATCT3’

Exon3:

Forward 5’ GGATCCACACATAAACCTAAAGAGAAATCA3’

Reverse 5’CTCGAGTATTGAAGCATATTACATACGATATGCTTCAATATCCAGGAGCAATGTGTTCT3’.

Amplification products were subcloned into pLOX-TKneo after removal of the HSV-TK cassette. The construct was linearized by digestion with NotI (Fig. S1A). ES cells from 129/SvEvTac blastocysts were electroporated with the linearized targeting construct. Seven hundred G418 resistant clones were screened by Southern blot. One positive clone was expanded and injected into C57BL/6 blastocysts implanted into pseudopregnant female mice. Chimeric mice were mated to C57BL/6 mice and germline transmission of the targeted allele was confirmed by PCR analysis. 3loxP Tgfbr3 heterozygotes were mated to EIIa-Cre transgenic mice. Progeny were screened by PCR for null alleles produced by Cre-mediated recombination. Heterozygous null mice were mated to generate homozygous null mice.


Record History
Added on November 16, 2021 at 11:07 AM by Skelton, Jennifer
Modified on November 16, 2021 at 11:19 AM by Skelton, Jennifer
Shared with (contributions)
VCMR: Vanderbilt Cryopreserved Mouse Repository Master
Request this Mouse Line

Mouse Information

Common Name Tgfbr3+/-
VCMR ID ADN
Date Cryopreserved 2021-09-14
Method of Cryopreservation Sperm
Trial IVF % Fertilization 76.00%

Genetic Alteration

Mutation #1: Targeted Mutagenesis
Allele Name: transforming growth factor, beta receptor III; targeted mutation 1.1, Joey V Barnett
Symbol: Tgfbr3tm1.1Jba
MGI: 3818438
Zygosity at cryopreservation Heterozygous
PCR Genotyping Protocol Genotyping_Protocol_ADN.pdf
Citations
Publication
Coronary vessel development is dependent on the type III transforming growth factor beta receptor. (2007) Circ Res 101: 784-91 (Added 8/13/2010)
PMID: 17704211

Background Strain Information

Strain Type Congenic Strain
Chimera/Founder Genetic Background 129S6/SvEvTac
Cryopreservation Strain Background (VCMR) C57BL/6J
Viability and Fertility Data

Homozygous lethal, heterozygous viable and fertile.