Other search tools

About this data

The publication data currently available has been vetted by Vanderbilt faculty, staff, administrators and trainees. The data itself is retrieved directly from NCBI's PubMed and is automatically updated on a weekly basis to ensure accuracy and completeness.

If you have any questions or comments, please contact us.

Results: 1 to 10 of 38

Publication Record

Connections

Effect of DNA-induced corrosion on passivated porous silicon biosensors.
Zhao Y, Lawrie JL, Beavers KR, Laibinis PE, Weiss SM
(2014) ACS Appl Mater Interfaces 6: 13510-9
MeSH Terms: Biosensing Techniques, Corrosion, DNA, DNA Probes, Magnesium, Optical Phenomena, Peptide Nucleic Acids, Porosity, Silanes, Silicon, Spectroscopy, Fourier Transform Infrared
Show Abstract · Added April 27, 2017
This work examines the influence of charge density and surface passivation on the DNA-induced corrosion of porous silicon (PSi) waveguides in order to improve PSi biosensor sensitivity, reliability, and reproducibility when exposed to negatively charged DNA molecules. Increasing the concentration of either DNA probes or targets enhances the corrosion process and masks binding events. While passivation of the PSi surface by oxidation and silanization is shown to diminish the corrosion rate and lead to a saturation in the changes by corrosion after about 2 h, complete mitigation can be achieved by replacing the DNA probe molecules with charge-neutral PNA probe molecules. A model to explain the DNA-induced corrosion behavior, consistent with experimental characterization of the PSi through Fourier transform infrared spectroscopy and prism coupling optical measurements, is also introduced.
0 Communities
1 Members
0 Resources
11 MeSH Terms
Viral detection using DNA functionalized gold filaments.
Perez JW, Haselton FR, Wright DW
(2009) Analyst 134: 1548-53
MeSH Terms: Biosensing Techniques, Child, DNA, DNA Probes, DNA, Viral, Enzyme-Linked Immunosorbent Assay, Gold, Humans, Limit of Detection, Nanostructures, Nucleic Acid Conformation, RNA, Viral, Respiratory Syncytial Viruses, Virus Replication
Show Abstract · Added May 27, 2014
Early detection of pediatric viruses is critical to effective intervention. A successful clinical tool must have a low detection limit, be simple to use and report results quickly. No current method meets all three of these criteria. In this report, we describe an approach that combines simple, rapid processing and label free detection. The method detects viral RNA using DNA hairpin structures covalently attached to a gold filament. In this design, the gold filament serves both to simplify processing and enable fluorescence detection. The approach was evaluated by assaying for the presence of respiratory syncytial virus (RSV) using the DNA hairpin probe 5' [C6Thiol]TTTTTTTTTTCGACGAAAAATGGGGCAAATACGTCG[CAL] 3' covalently attached to a 5 cm length of a 100 microm diameter gold-clad filament. This sequence was designed to target a portion of the gene end-intergenic gene start signals which is repeated multiple times within the negative-sense genome giving multiple targets for each strand of genomic viral RNA present. The filament functionalized with probes was immersed in a 200 microm capillary tube containing viral RNA, moved to subsequent capillary tubes for rinsing and then scanned for fluorescence. The response curve had a typical sigmoidal shape and plateaued at about 300 plaque forming units (PFU) of viral RNA in 20 microL. The lower limit of detection was determined to be 11.9 PFU. This lower limit of detection was approximately 200 times better than a standard comparison ELISA. The simplicity of the core assay makes this approach attractive for further development as a viral detection platform in a clinical setting.
0 Communities
1 Members
0 Resources
14 MeSH Terms
Kinase expression and chromosomal rearrangements in papillary thyroid cancer tissues: investigations at the molecular and microscopic levels.
Weier HU, Kwan J, Lu CM, Ito Y, Wang M, Baumgartner A, Hayward SW, Weier JF, Zitzelsberger HF
(2009) J Physiol Pharmacol 60 Suppl 4: 47-55
MeSH Terms: Animals, Carcinoma, Papillary, Cell Line, Cell Transplantation, Chernobyl Nuclear Accident, Chromosome Aberrations, Chromosomes, Chromosomes, Artificial, Bacterial, Cloning, Molecular, DNA Probes, Flow Cytometry, Humans, Image Processing, Computer-Assisted, Karyotyping, Mice, Protein Kinases, Receptor Protein-Tyrosine Kinases, Receptor, trkA, Reverse Transcriptase Polymerase Chain Reaction, Thyroid Neoplasms, Translocation, Genetic
Show Abstract · Added May 27, 2014
Structural chromosome aberrations are known hallmarks of many solid tumors. In the papillary form of thyroid cancer (PTC), for example, activation of the receptor tyrosine kinase (RTK) genes, ret or the neurotrophic tyrosine kinase receptor type I (NTRK1) by intra- or interchromosomal rearrangements have been suggested as a cause of the disease. The 1986 accident at the nuclear power plant in Chernobyl, Ukraine, led to the uncontrolled release of high levels of radioisotopes. Ten years later, the incidence of childhood papillary thyroid cancer (chPTC) near Chernobyl had risen by two orders of magnitude. Tumors removed from some of these patients showed aberrant expression of the ret RTK gene due to a ret/PTC1 or ret/PTC3 rearrangement involving chromosome 10. However, many cultured chPTC cells show a normal G-banded karyotype and no ret rearrangement. We hypothesize that the "ret-negative" tumors inappropriately express a different oncogene or have lost function of a tumor suppressor as a result of chromosomal rearrangements, and decided to apply molecular and cytogenetic methods to search for potentially oncogenic chromosomal rearrangements in Chernobyl chPTC cases. Knowledge of the kind of genetic alterations may facilitate the early detection and staging of chPTC as well as provide guidance for therapeutic intervention.
0 Communities
1 Members
0 Resources
21 MeSH Terms
External quality assessment of HLA-B*5701 reporting: an international multicentre survey.
Hammond E, Almeida CA, Mamotte C, Nolan D, Phillips E, Schollaardt TA, Gill MJ, Angel JB, Neurath D, Li J, Giulivi T, McIntyre C, Koultchitski G, Wong B, Reis M, Rachlis A, Cole DE, Chew CB, Neifer S, Lalonde R, Roger M, Jeanneau A, Mallal S
(2007) Antivir Ther 12: 1027-32
MeSH Terms: Alleles, Anti-HIV Agents, DNA Primers, DNA Probes, HLA, Dideoxynucleosides, Drug Hypersensitivity, Genetic Testing, HLA-B Antigens, Humans, Polymerase Chain Reaction, Quality Control, Reproducibility of Results, Sensitivity and Specificity
Show Abstract · Added March 30, 2020
OBJECTIVES - HLA-B*5701 strongly predicts abacavir hypersensitivity (HSR), but implementation of effective routine screening into clinical practice requires testing be practical and accurate. We tested the proficiency of HLA-B*5701 typing among laboratories using sequence-specific primer PCR.
DESIGN AND METHODS - DNA panels (1 and 2) were distributed to seven laboratories (A to G) for blinded typing of the HLA-B*5701 allele. Panel 1 (n = 10 samples; n = 7 laboratories) included 3 positives and other closely related B17 subtypes (B*5702, B*5703, B*5704 and B*5801). Panel 2 (n = 96 samples; n = 4 laboratories) included 36 positives among a broad spectrum of other B alleles. Two laboratories (A and B) also submitted 96 routine samples, typed by the same methodology, to the reference centre for additional analysis by sequence-based typing.
RESULTS - All laboratories correctly typed panel 1 for HLA-B*5701 carriage. Laboratories A, B and C identified HLA-B*5701 alleles in panel 2 with 100% sensitivity and 100% specificity. Laboratory D reported one false negative, reportedly due to a sampling error. The results obtained for routine samples typed by laboratories A and B and those generated by the reference laboratory using sequencing were fully concordant.
CONCLUSIONS - Detection of HLA-B*5701 alleles among laboratories was 100% specific and 99.4% sensitive, indicating that participating HIV testing laboratories were currently offering effective primary screening to identify individuals at high risk of abacavir HSR. Accurate reporting of HLA-B*5701 status is critical for the safe administration of this drug and participation in quality assurance programmes by all sites who report HLA-B*5701 status should be promoted.
0 Communities
1 Members
0 Resources
MeSH Terms
Hu/Mu ProtIn oligonucleotide microarray: dual-species array for profiling protease and protease inhibitor gene expression in tumors and their microenvironment.
Schwartz DR, Moin K, Yao B, Matrisian LM, Coussens LM, Bugge TH, Fingleton B, Acuff HB, Sinnamon M, Nassar H, Platts AE, Krawetz SA, Linebaugh BE, Sloane BF
(2007) Mol Cancer Res 5: 443-54
MeSH Terms: Animals, Cell Line, Tumor, DNA Probes, Gene Expression Profiling, Gene Expression Regulation, Enzymologic, Gene Expression Regulation, Neoplastic, Humans, Mice, Neoplasms, Oligonucleotide Array Sequence Analysis, Peptide Hydrolases, Protease Inhibitors, RNA, Messenger, Reference Standards, Sensitivity and Specificity, Transplantation, Heterologous
Show Abstract · Added March 5, 2014
Proteolysis is a critical regulatory mechanism for a wide variety of physiologic and pathologic processes. To assist in the identification of proteases, their endogenous inhibitors, and proteins that interact with proteases or proteolytic pathways in biological tissues, a dual-species oligonucleotide microarray has been developed in conjunction with Affymetrix. The Hu/Mu ProtIn microarray contains 516 and 456 probe sets that survey human and mouse genes of interest (proteases, protease inhibitors, or interactors), respectively. To investigate the performance of the array, gene expression profiles were analyzed in pure mouse and human samples (reference RNA; normal and tumor cell lines/tissues) and orthotopically implanted xenografts of human A549 lung and MDA-MB-231 breast carcinomas. Relative gene expression and "present-call" P values were determined for each probe set using dChip and MAS5 software, respectively. Despite the high level of sequence identity of mouse and human protease/inhibitor orthologues and the theoretical potential for cross-hybridization of some of the probes, >95% of the "present calls" (P<0.01) resulted from same-species hybridizations (e.g., human transcripts to human probe sets). To further assess the performance of the microarray, differential gene expression and false discovery rate analyses were carried out on human or mouse sample groups, and data processing methods to optimize performance of the mouse and human probe sets were identified. The Hu/Mu ProtIn microarray is a valuable discovery tool for the identification of components of human and murine proteolytic pathways in health and disease and has particular utility in the determination of cellular origins of proteases and protease inhibitors in xenograft models of human cancer.
1 Communities
1 Members
0 Resources
16 MeSH Terms
A comparison of cytology and fluorescence in situ hybridization for the detection of lung cancer in bronchoscopic specimens.
Halling KC, Rickman OB, Kipp BR, Harwood AR, Doerr CH, Jett JR
(2006) Chest 130: 694-701
MeSH Terms: Adolescent, Adult, Aged, Aged, 80 and over, Bronchi, Bronchoalveolar Lavage, Bronchoscopy, Chromosome Aberrations, Cytodiagnosis, DNA Probes, DNA, Neoplasm, Female, Humans, In Situ Hybridization, Fluorescence, Lung Neoplasms, Male, Middle Aged, Prospective Studies, Sensitivity and Specificity
Show Abstract · Added March 5, 2014
STUDY OBJECTIVES - To determine the relative sensitivity and specificity of cytology and fluorescence in situ hybridization (FISH) for the detection of lung cancer in bronchoscopically obtained specimens.
DESIGN - Cytology and FISH were performed on brushing and washing specimens obtained from patients undergoing bronchoscopy for suspected lung cancer. FISH utilized the LAVysion probe set (Abbott Molecular; Des Plaines, IL), which contains locus-specific probes to 5p15, 7p12 (EGFR), 8q24 (C-MYC), and a centromeric probe to chromosome 6.
SETTING - Single-center, academic, tertiary medical center.
PARTICIPANTS - One hundred thirty-seven patients referred for bronchoscopy for suspicion of lung cancer.
INTERVENTIONS - Cytology and FISH were performed on bronchoscopic brushings and washings.
MEASUREMENTS AND RESULTS - One hundred thirty-seven patients undergoing bronchoscopy had pathology, FISH, and cytology results. FISH and cytology were performed on 123 washing and 78 brushing specimens. Sensitivities of FISH and cytology were 71% and 51% (p = 0.007), respectively, for brushing specimens, and 49% and 44% (p = 0.541) for washing specimens. When FISH and cytology results were combined, sensitivities were 75% and 61%, respectively, for brushing and washing specimens, which was significantly better (p < 0.001) than cytology alone. Specificities of FISH and cytology for patients with negative findings at the time of initial bronchoscopy were 83% and 100% (p = 0.125), respectively, for brushing specimens, and 95% and 100% (p = 0.500) for washing specimens.
CONCLUSIONS - These findings show that FISH is significantly more sensitive than conventional cytology for detecting lung cancer in bronchial brushing specimens; when combined with cytology, FISH can improve the diagnostic sensitivity of detecting malignancy in bronchial brushing and washing specimens.
0 Communities
1 Members
0 Resources
19 MeSH Terms
DNA self-polymers as microarray probes improve assay sensitivity.
Hollingshead D, Korade Z, Lewis DA, Levitt P, Mirnics K
(2006) J Neurosci Methods 151: 216-23
MeSH Terms: DNA, DNA Probes, Dimerization, Equipment Design, Equipment Failure Analysis, In Situ Hybridization, Fluorescence, Microchemistry, Oligonucleotide Array Sequence Analysis, Reproducibility of Results, Sensitivity and Specificity
Show Abstract · Added February 12, 2015
DNA microarrays provide a method for determining the expression levels of thousands of genes simultaneously. However, the phenotypic complexity of brain tissue and cross-dilution of transcripts from different sources make it difficult to detect many of the low abundance RNA species. Furthermore, these experiments require significant amounts of starting material, which must often be amplified by one or two rounds of T7 amplification. We have developed a novel microarray probe with increased sensitivity. In this approach, PCR-generated microarray probes are end-ligated into redundant polymers and printed on standard arraying surfaces. These DNA polymer probes result in greatly improved sensitivity over classical monomer probes. Furthermore, polymer microarray sensitivity can be even further improved by incorporation of a biotin adapter into the first strand cDNA during reverse transcription and attachment of a gold particle (Genicon RLS, Invitrogen, CA) in a secondary reaction. This approach allowed us to reliably assess: expression of genes from < 5 microg of total RNA starting material without sample amplification. Finally, the resonance light scattering-labeled microarrays can be archived without fading, allowing re-scanning at a later time.
0 Communities
1 Members
0 Resources
10 MeSH Terms
Mini-and microsatellite mutations in children from Chernobyl accident cleanup workers.
Slebos RJ, Little RE, Umbach DM, Antipkin Y, Zadaorozhnaja TD, Mendel NA, Sommer CA, Conway K, Parrish E, Gulino S, Taylor JA
(2004) Mutat Res 559: 143-51
MeSH Terms: Adult, Child, DNA Probes, Dose-Response Relationship, Radiation, Female, Humans, Lymphocytes, Male, Microsatellite Repeats, Minisatellite Repeats, Mutation, Occupational Exposure, Paternal Exposure, Radioactive Hazard Release, Ukraine
Show Abstract · Added March 5, 2014
Knowledge about possible genotoxic effects of low-dose radiation on the human germline is limited and relies primarily on extrapolations from high-dose exposures. To test whether ionizing radiation can cause paternal genetic mutations that are transmitted to offspring, we enrolled families of 88 Chernobyl cleanup workers exposed to ionizing radiation. We analyzed DNA isolated from lymphocytes for mutations via DNA blotting with the multi-locus minisatellite probes 33.6 and 33.15 and via PCR in a panel of six tetranucleotide repeats. Children conceived before and children conceived after their father's exposure showed no statistically significant differences in mutation frequencies. We saw an increase in germline microsatellite mutations after radiation exposure that was not statistically significant. We found no dependence of mutation rate on increasing exposure. A novel finding was that the tetranucleotide marker D7S1482 demonstrated germline hypermutability. In conclusion, our results do not support an increased level of germline minisatellite mutations but suggest a modest increase in germline mutations in tetranucleotide repeats. Small sample size, however, limited statistical power.
0 Communities
1 Members
0 Resources
15 MeSH Terms
Chaotic mixer improves microarray hybridization.
McQuain MK, Seale K, Peek J, Fisher TS, Levy S, Stremler MA, Haselton FR
(2004) Anal Biochem 325: 215-26
MeSH Terms: DNA, DNA Probes, Oligonucleotide Array Sequence Analysis
Show Abstract · Added May 27, 2014
Hybridization is an important aspect of microarray experimental design which influences array signal levels and the repeatability of data within an array and across different arrays. Current methods typically require 24h and use target inefficiently. In these studies, we compare hybridization signals obtained in conventional static hybridization, which depends on diffusional target delivery, with signals obtained in a dynamic hybridization chamber, which employs a fluid mixer based on chaotic advection theory to deliver targets across a conventional glass slide array. Microarrays were printed with a pattern of 102 identical probe spots containing a 65-mer oligonucleotide capture probe. Hybridization of a 725-bp fluorescently labeled target was used to measure average target hybridization levels, local signal-to-noise ratios, and array hybridization uniformity. Dynamic hybridization for 1h with 1 or 10ng of target DNA increased hybridization signal intensities approximately threefold over a 24-h static hybridization. Similarly, a 10- or 60-min dynamic hybridization of 10ng of target DNA increased hybridization signal intensities fourfold over a 24h static hybridization. In time course studies, static hybridization reached a maximum within 8 to 12h using either 1 or 10ng of target. In time course studies using the dynamic hybridization chamber, hybridization using 1ng of target increased to a maximum at 4h and that using 10ng of target did not vary over the time points tested. In comparison to static hybridization, dynamic hybridization reduced the signal-to-noise ratios threefold and reduced spot-to-spot variation twofold. Therefore, we conclude that dynamic hybridization based on a chaotic mixer design improves both the speed of hybridization and the maximum level of hybridization while increasing signal-to-noise ratios and reducing spot-to-spot variation.
0 Communities
1 Members
0 Resources
3 MeSH Terms
Molecular beacon sequence design algorithm.
Monroe WT, Haselton FR
(2003) Biotechniques 34: 68-70, 72-3
MeSH Terms: Algorithms, Base Sequence, Combinatorial Chemistry Techniques, Computer-Aided Design, DNA Probes, Databases, Nucleic Acid, Equipment Design, Fluorescence, Internet, Molecular Probe Techniques, Molecular Sequence Data, Oligonucleotides, Sequence Alignment, Sequence Analysis, DNA, Software
Show Abstract · Added May 27, 2014
A method based on Web-based tools is presented to design optimally functioning molecular beacons. Molecular beacons, fluorogenic hybridization probes, are a powerful tool for the rapid and specific detection of a particular nucleic acid sequence. However, their synthesis costs can be considerable. Since molecular beacon performance is based on its sequence, it is imperative to rationally design an optimal sequence before synthesis. The algorithm presented here uses simple Microsoft Excel formulas and macros to rank candidate sequences. This analysis is carried out using mfold structural predictions along with other free Web-based tools. For smaller laboratories where molecular beacons are not the focus of research, the public domain algorithm described here may be usefully employed to aid in molecular beacon design.
0 Communities
1 Members
0 Resources
15 MeSH Terms